pegRNA Design Platform for Plant Prime Editing

Plant Prime
Editor v1.0

Precision pegRNA design, from allelic variant to cloning-ready construct — in three guided steps.

A comprehensive bioinformatics tool for designing, validating and preparing pegRNA constructs optimised for plant prime editing systems — supporting PE2, PE2max, PE3, PE3b, PE4/PE5, ePPE, PPE/ePPE3, and twinPE with 13 validated binary vectors, ΔG thermodynamic scoring, and 5 core cloning strategies.

See How It Works
10
PE Systems
13
Validated Vectors
5
Cloning Methods
3
Module Pipeline
pegRNA–DNA Interaction Diagrams
PE2max interaction diagram — single pegRNA with tevopreQ1 motif on nCas9-RT complex
PE2 Single cassette · No tevo
pegRNA
Spacer (20 nt)
Scaffold (76 nt)
RT Template
PBS
PolyT
nSpCas9(H840A)–MMLV-RT + single pegRNA. No tevopreQ1 motif. Best starting point for all plant species.
PE2max Single cassette · tevo ✓
pegRNA
Spacer
Scaffold (76 nt)
RT
PBS
Lnk
tevopreQ1 (37 nt)
PE2 + linker (ΔG-optimised, 19 candidates) + tevopreQ1 pseudoknot stabilises pegRNA 3′ extension. Nelson 2022 Nat Chem Biol.
PE3 / PE3b Dual cassette · No tevo
pegRNA
Spacer
Scaffold
RT
PBS
PolyT
Nick sgRNA
Nick Spacer (40–80 nt optimal; 30–100 nt acceptable)
Scaffold
PE3: second nick on the non-edited strand (any nearby PAM). PE3b: second nick on the edited strand (same as pegRNA) — PAM must be disrupted by the edit, making the nick conditional (2–4× fewer indels). 1.5–2× efficiency gain. Anzalone 2019 · Li 2022.
PE4 / PE5 Dual cassette · No tevo · MLH1dn
pegRNA
Spacer
Scaffold
RT
PBS
PolyT
Nick sgRNA
Nick Spacer
Scaffold
MLH1dn
AtMLH1dn / OsMLH1dn — co-expressed from same T-DNA (suppresses MMR)
PE3/PE3b + dominant-negative MLH1 (AtMLH1dn/OsMLH1dn) co-expressed from same T-DNA suppresses mismatch repair. ~2–5× in plants (Xu 2023); 3–10× in human cells (Chen 2021 Cell).
ePPE Single cassette · Engineered RT · tevo ✓
pegRNA
Spacer
Scaffold
RT
PBS
Lnk
tevo
nCas9–RT
L603W · T330P · D200N · T306K · W313F · ΔRNaseH + NC chaperone
Same pegRNA structure as PE2max. Engineered RT protein gives avg 5.8× over PE2 in rice. No second pegRNA cassette needed. Zong 2022 Nat Biotechnol.
PPE / ePPE3 Dual cassette · Paired pegRNAs · tevo ✓
pegRNA-1
Sp-1
Scaffold
RT1
PBS1
Lnk
tevo
pegRNA-2
Sp-2
Scaffold
RT2=RC(PBS1)
PBS2=RC(RT1)
Lnk
tevo
Two opposite-strand pegRNAs each encoding the same edit. Complementary 3′ flap resolution reduces MMR interference. ePPE3 = PPE + ePPE engineered RT. Lin 2021 Nat Biotechnol.
twinPE Dual cassette · No tevo · Large edits ≤700 bp
pegRNA-1
Sp-1 (+strand)
Scaffold
RT1 (left flap)
PBS1
PolyT
pegRNA-2
Sp-2 (−strand)
Scaffold
RT2 (right flap)
PBS2
PolyT
Nick dist
31–60 nt (acceptable) · 34–50 nt plant-optimal (Li 2022) · RT1 and RT2 generate complementary 3′ flaps
Two convergent pegRNAs on opposite strands generate complementary 3′ DNA flaps (one from each RT). The flaps anneal to each other and are incorporated by cellular DNA repair, enabling large deletions, insertions, and replacements up to ~700 bp. No tevopreQ1. Anzalone 2022 Nat Biotechnol.
About the Platform

What is Plant Prime Editing?

Prime editing is a next-generation CRISPR technology that enables precise, programmable genomic edits — including substitutions, small insertions, and deletions — without requiring double-strand DNA breaks or exogenous donor templates.

At the heart of prime editing is the pegRNA (prime editing guide RNA), a chimeric molecule that carries both the target-site spacer and the edit-encoding RT template with a primer binding site (PBS). Designing pegRNAs that function efficiently in plant cells requires careful consideration of spacer selection, PBS length, RT template composition, promoter compatibility, and cloning architecture.

Plant Prime Editor v1.0 automates this entire workflow — from allelic variant alignment to cloning-ready primer sets and step-by-step lab protocols — tailored specifically for major plant species and vector systems. All computation runs client-side; no sequence data leaves your browser.

pegRNA Architecture (PE2max / ePPE / PPE / ePPE3 — tevopreQ1 systems)
Spacer
5′ — Spacer (20 nt)
Scaffold
sgRNA Scaffold (76 nt)
RT Tmpl
RT Template (encodes edit)
PBS
PBS (13–17 nt)
Linker
Lnk
tevopreQ1
tevopreQ1 (PE2max / ePPE / PPE / ePPE3)
Spacer
Scaffold
RT Template
PBS
tevopreQ1
SpCas9 sgRNA Scaffold (76 nt) — embedded in all pegRNA primer designs
GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC     GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC     GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC     GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC
Three-Module Pipeline

From Allelic Variant to Construct Design

A linear guided workflow that takes you from CDS sequences all the way to cloning-ready primers and complete lab protocols.

01
🧬
Module 1
Allelic Variant Finder
Paste wild-type and reference CDS sequences. Needleman–Wunsch alignment with affine gap penalty detects every SNP, insertion, and deletion in codon context with amino acid impact prediction. Select edits, then fetch the full genomic sequence from 8 integrated databases: NCBI, TAIR, Ensembl Plants, RAPdb, RGAP/MSU, Sol Genomics, Gramene, and Phytozome.
NW alignment — SNP, insertion & deletion detection
Codon context & AA impact (Conservative / Non-conservative)
Multi-edit selection support
8 genomic databases — NCBI · TAIR · Ensembl Plants · RAPdb · RGAP/MSU · Sol Genomics · Gramene · Phytozome
CSV export of variant data
02
⚙️
Module 2
pegRNA Designer
Scans both strands for PAM sites (NGG, NG, NNGRRT, SpRY NRN/NYN). Scores spacers on nick-to-edit distance, GC%, seed quality, and ΔG. Interactive PBS heatmap (8–22 nt) includes PBS↔RT interaction. Designs nick sgRNA, PPE paired pegRNA, and twinPE. Selects linker from 19 candidates via SantaLucia ΔG.
Scored spacer candidates (both strands, IUPAC PAM)
PBS ΔG heatmap (8–22 nt, PBS↔RT weighted)
RT template for single & multi-edit designs
ΔG-optimised linker (19 candidates)
Nick sgRNA / PPE pegRNA-2 / twinPE dual design
Annotated sequence interaction diagram
03
🧪
Module 3
Cloning & Primers
Select from 13 validated plant PE binary vectors with cassette badges. Smart ranking by PE system, plant type, and Addgene availability. RE site conflict scan prevents BsaI/BsmBI sites in insert. Five core cloning strategies generate primer sets P1–P12 / PT1–PT4 with full thermodynamic QC and PCR cycling conditions. Direct Assembly mode accepts manual pegRNA sequences without needing Module 2.
13 binary vectors — smart recommendation
RE site conflict scan (BsaI, BsmBI, BbsI, Esp3I)
Primers P1–P12 with Tm, GC%, self-comp, dimer QC
P1:P3 heterodimer & P3 scaffold fold check
PCR cycling conditions (NEB Q5 Hot-Start)
IDT bulk CSV, Twist order & protocol text export
Direct Assembly mode — enter spacer/RT/PBS manually, skip Module 2
5 cloning strategies — BsaI GG · BsmBI · Esp3I · One-Step PCR+Gibson · gBlock+Gibson
Platform Capabilities

Built for Precision

🌱
Plant-Optimised Scoring
PBS Tm ~30°C optimal, PBS length 11–15 nt, and RT limits calibrated for plant prime editing. G-start enforced for U3/U6 promoters. Poly-T (TTTT) terminator detection. Lin 2021 · Anzalone 2019 · Chen 2021.
Dicot & Monocot
🔬
10 PE Systems Supported
Full support for PE2, PE2max, PE3, PE3b, PE4/PE5 (MLH1dn), ePPE (Zong 2022), PPE, ePPE3 (Lin 2021), and twinPE (Anzalone 2022) — 10 systems total — each with a tailored primer pipeline, vector filter, and complete protocol.
All Major Systems
⚡
Overlap Extension PCR
Automatic mega-primer design (P1–P12, PT1–PT4). PCR conditions panel with NEB Q5 cycling parameters computed from actual primer Tms. P1:P3 heterodimer detection, P3 scaffold fold risk, P1/P2 Tm mismatch advisory.
OE-PCR Assembly
🔄
5 Cloning Strategies
BsaI Golden Gate · BsmBI swap · Esp3I isoschizomer · One-Step PCR + Gibson (Lin 2021) · gBlock + Gibson — plus Gibson Assembly, In-Fusion HD, and Full-cassette RE. Each generates correct RE tail orientations and overhang sequences.
Flexible Cloning
🧫
RE Site Conflict Checking
Automatically scans the full pegRNA insert for internal BsaI, BsmBI, BbsI, and Esp3I recognition sites that would interfere with Golden Gate cloning, with highlighted conflict positions and strategy switching guidance.
Quality Control
📋
Full Lab Protocol Export
Complete step-by-step protocol: PCR conditions, thermocycler programs, Golden Gate or Gibson ligation, transformation parameters, colony screening. Export as IDT bulk CSV, Twist fragment order, or formatted text file.
Wet Lab Ready
✏️
Direct Assembly Mode
Skip Module 1 & 2 entirely — enter your spacer, RT template, PBS (and nick sgRNA / pegRNA-2 for paired systems) directly in Module 3. The tool builds the full m2Data structure, recommends vectors, and generates all cloning primers from your manual sequences.
Module 3 · All PE systems
🔄
Intelligent Reset System
Six targeted reset points throughout the tool: Full session reset, Start Fresh on home page, M1 Clear Sequences (keeps M2/M3), M2 Re-design (keeps genomic sequence), M3 Start New Design, and DA Clear Fields. Each preserves data that isn't being reset.
Nav · M1 · M2 · M3
🌡️
Thermodynamic ΔG Scoring
Every pegRNA component is evaluated using the SantaLucia 1998 nearest-neighbour model. The PBS ΔG heatmap (8–22 nt) scores six interaction channels simultaneously — PBS↔RT template (weighted 1.5×, the #1 pegRNA failure mode per Chen 2021), PBS↔Spacer, PBS↔Scaffold 3′, PBS self-fold, Spacer↔Scaffold 5′, and Spacer self-fold. The linker is auto-selected from 19 candidates by minimising 3′-extension ΔG. Cells below −12 kcal/mol flag critical risk in red. Spacer structural scoring integrates ΔG alongside nick distance, GC%, seed GC, G-start, and poly-T penalty for a unified ranking score.
SantaLucia NN Model
Supported Systems

Prime Editing Architectures

Each system has a tailored primer design pipeline, module card set, and protocol — no manual adaptation needed.

PE2
Baseline system. nSpCas9(H840A)–MMLV-RT + single pegRNA. Use to establish prime editing in a new plant system. All species supported.
Single cassette
PE2max
PE2 + tevopreQ1 pseudoknot at pegRNA 3′ end. Stabilises 3′ extension fold. Linker selected from 19 candidates by ΔG. Nelson 2022.
tevopreQ1
PE3
PE2 + nick sgRNA on non-edited strand (30–100 nt range, 40–80 nt optimal). pegRNA has no tevopreQ1. 1.5–2× efficiency. Requires dual-cassette vector. Anzalone 2019 · Li 2022.
Nick sgRNA
PE3b
Nick sgRNA PAM disrupted by the installed edit — cuts only after editing. Reduces indel byproducts 2–4× vs PE3. Anzalone 2019.
Low Indels
PE4 / PE5
PE3/PE3b + dominant-negative MLH1 (AtMLH1dn/OsMLH1dn) co-expression suppresses MMR. ~2–5× in plants (Xu 2023); 3–10× in human cells (Chen 2021).
MLH1dn · MMR suppression
ePPE
Single cassette. Engineered MMLV-RT (L603W, T330P, D200N, T306K, W313F + ΔRNaseH) + NC chaperone. Same pegRNA structure as PE2max (tevo included). 5.8× over PE2. Zong 2022.
Monocot · 5.8×
PPE / ePPE3
Paired pegRNAs on opposite strands, both encoding the same edit. Reduces MMR interference via complementary flap resolution. Highest plant PE efficiency reported. Lin 2021.
Paired pegRNA
twinPE
Two pegRNAs with complementary 3′ flaps for large deletions, insertions, and replacements up to ~700 bp. Anzalone 2022 Nat Biotechnol.
Large Edits · 700 bp
Validated Species

Designed for Major Crops

🌾 Wheat (Triticum aestivum)
🌾 Rice (Oryza sativa)
🌽 Maize (Zea mays)
🍅 Tomato (Solanum lycopersicum)
🥬 Arabidopsis thaliana
🫘 Soybean (Glycine max)
🫚 Canola (Brassica napus)
🌿 Tobacco (Nicotiana benthamiana)
🥔 Potato (Solanum tuberosum)
🌱 Custom species
Technical Documentation

Platform Documentation

Design rules, algorithms, and biological references used throughout the pipeline.

🔤 Key Biological Sequences
sgRNA Scaffold (SpCas9, 76 nt)
GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC
Lin 2020 Nat Plants · embedded in P2, P3 mega-primer annealing region
tevopreQ1 motif (37 nt) — PE2max / ePPE / PPE / ePPE3
CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA
Nelson 2022 Nat Chem Biol · appended to pegRNA 3′ end after linker
Default Linker (9 nt, Nelson 2022)
GCAAAAAAA
ΔG-optimised from 19 candidates via SantaLucia 1998 nearest-neighbour model
PolyT Terminator (Pol III)
TTTTTT
Appended to all pegRNA synthesis orders · Li 2022 Nat Plants
✂ Spacer Scoring Algorithm
Nick-to-edit distance (dominant factor)
3–15 nt: optimal (50 pts) · 16–25 nt: good (35 pts) · 26–34 nt: marginal (15 pts) · >34 nt: poor (−30 pts). For multi-edit designs, governed by the farthest edit. Anzalone 2019.
GC content
45–60%: optimal (20 pts) · 40–65%: acceptable (14 pts). Chen 2021.
Seed region (nt 9–20 from spacer 5′ end, PAM-proximal)
35–60% GC: optimal (10 pts). Hsu 2013 Nat Biotechnol.
G-start
+8 pts if spacer begins with G (U3/U6 Pol III requirement). Li 2022.
Poly-T penalty
TTTT run: −25 pts (Pol III terminator signal in plant cells). Li 2022.
ΔG structure penalty
Spacer ↔ Scaffold 5′ and Spacer self-fold checked via SantaLucia NN model. Dang 2015.
🧬 PBS Design Rules
Optimal length
11–15 nt for plants (Lin 2021 Nat Biotechnol — Tm ~30°C window) · 8–17 nt acceptable (Anzalone 2019 · Chen 2021).
Tm (SantaLucia 1998 nearest-neighbour model)
28–32°C: plant-optimal · 25–37°C: acceptable. Computed via SantaLucia 1998 NN model with Owczarzy 2008 Na+/Mg²+ correction. Plant PE optimum ~30°C established by Lin 2021 Nat Biotechnol 39:923 (PlantPegDesigner, validated across 18 rice sites).
GC content
40–60%: optimal (25 pts) · 35–65%: acceptable (14 pts). Chen 2021.
PBS ↔ RT interaction (heatmap)
#1 pegRNA failure mode (Chen 2021 Fig 4). Weighted 1.5× in ΔG heatmap. SantaLucia 1998 NN parameters.
Additional ΔG checks
PBS↔Spacer · PBS↔Scaffold 3′ · PBS self-fold. Critical ΔG < −12 kcal/mol flags red.
3′-G run penalty
GGG at 3′ end: −8 pts (G-quadruplex risk). Huppert 2007.
📐 RT Template Design
Length limits
Plant optimal: 14–20 nt (Li 2022 Nat Plants) · Acceptable: 10–30 nt (Chen 2021) · Upper cap: 60 nt (efficiency drops sharply beyond, Li 2022). Default search window: 10–30 nt; auto-expands when multi-edit span requires it.
Edit placement
All edits must lie between nick and far end of RT template. Min 5 nt from PBS-proximal end. Anzalone 2019.
Multi-edit support
All selected SNPs/indels encoded in a single continuous RT template. Span ≤ 34 nt from nick recommended. Chen 2021 · Anzalone 2022.
Strand geometry
+ strand: PBS = RC(genomic[nickPos−len..nickPos−1]); RT = RC(genomic[nickPos..nickPos+len−1]) with edits. − strand: PBS = genomic[nickPos+1..nickPos+len] directly (NO outer RC); RT = genomic[nickPos−len+1..nickPos] with edits (NO outer RC). PBS and RT regions are non-overlapping by construction. Anzalone 2019 Fig 1c geometry; PBS↔spacer auto-inhibitory complementarity per Liu lab 2022 / NAR 2025.
🧪 Cloning Strategies
BsaI Golden Gate (default)
ACCG/AAAC overhangs for cassette 1 · ACCG/CGTG for nick cassette 2. Lin 2020 Nat Plants.
BsmBI cassette swap
Compatible with pRGEB57, pYPQ140. CACCG fwd tail · AAAC rev tail. Li 2022.
Esp3I / Eco31I isoschizomer
Identical cut to BsaI. Esp3I (Thermo ER0201) preferred for nick sgRNA cassette 2 in PE3/PE3b. Jin 2023 Nat Protoc.
One-Step PCR + Gibson
Single PCR on vector plasmid with mega-primer P_OS_Rev_Arm, then NEBuilder HiFi assembly. Fastest strategy (1 day). Lin 2021 Nat Biotechnol.
gBlock + Gibson
Order full insert as IDT gBlock (≤ 3000 nt) or Twist fragment, then Gibson assemble into linearised vector. No PCR required.
Gibson Assembly (NEBuilder HiFi)
Sequence-agnostic assembly using 20–25 bp vector homology arms. Best all-round fallback when RE site conflicts arise. NEBuilder HiFi (NEB E2621), 50°C 15–60 min. Primers P_Gibson_Fwd / P_Gibson_Rev generated automatically.
In-Fusion HD (Takara Bio)
Exonuclease-based assembly with 15 bp arms. Faster than NEBuilder HiFi (15 min reaction). Sequence-agnostic. Use Takara In-Fusion HD Cloning Kit (Catalog 638910).
Full-cassette RE cloning
Restriction enzyme + ligation of complete U6-promoter–pegRNA–terminator cassette (~900–1200 bp insert including U6 promoter). Used when internal RE sites conflict with Golden Gate.
🌐 Genomic Sequence Databases (Module 1)
🔬 NCBI
Gene ID (e.g. 4331618), nucleotide accession (NM_001061271), or locus symbol (OsALS1). Covers all species.
🌿 TAIR (Arabidopsis)
AT locus IDs (AT1G01010–AT5G67640). Fetched via Ensembl Plants (TAIR10 annotation) with NCBI Gene fallback — TAIR's direct REST API blocks browser CORS.
🌱 Ensembl Plants
Arabidopsis, rice, maize, tomato. IDs: AT*, Os*, GRMZM*, Solyc*. Via Ensembl REST API.
🌾 RAPdb / RGAP/MSU (Rice)
RAP loci (Os##g#######) and MSU loci (LOC_Os##g#####). Fetched via NCBI Gene with Oryza sativa filter.
🍅 Sol Genomics / 🌿 Gramene / 🧬 Phytozome
Sol Genomics: ITAG gene models (Solyc*). Gramene: wheat/barley/sorghum/Brachypodium via EnsemblGenomes. Phytozome: JGI portal (opens browser, login required).
🔬 PE System Reference
PE2 / PE2max
nSpCas9(H840A)–MMLV-RT. PE2max adds tevopreQ1 (Nelson 2022). Single cassette. All plant species.
PE3 / PE3b
+ nick sgRNA on non-edited strand (40–90 nt, optimal). 1.5–2× efficiency gain (Li 2022). PE3b: nick PAM disrupted by edit → fewer indels (2–4× fewer vs PE3). Dual cassette.
PE4 / PE5
PE3/PE3b + AtMLH1dn / OsMLH1dn. Suppresses MMR. ~2–5× gain in plants (Xu 2023); 3–10× in human cells (Chen 2021).
ePPE
Engineered MMLV-RT (L603W, T330P, D200N, T306K, W313F + ΔRNaseH) + NC chaperone fused to nCas9. 5.8× over PE2, benchmarked in rice. Zong 2022 Nat Biotechnol.
PPE / ePPE3
Paired opposite-strand pegRNAs. RT2 = RC(PBS1), PBS2 = RC(RT1 proximal 13 nt). Reduces MMR interference via complementary flap resolution. Lin 2021 Nat Biotechnol.
twinPE
Two convergent pegRNAs. Complementary 3′ flaps recombine. Nick-to-nick 31–60 nt (optimal 34–50). Up to ~700 bp. Anzalone 2022 Nat Biotechnol.
📚 Key References
1Anzalone AV et al. (2019) Nature 576:149 — Prime editing
2Lin Q et al. (2020) Nat Plants 6:888 — Arabidopsis PE
3Lin Q et al. (2020) Nat Biotechnol 38:582 — Rice PE
4Chen PJ et al. (2021) Cell 184:5635 — RT↔PBS failure mode
5Lin Q et al. (2021) Nat Biotechnol 39:923 — PPE
6Li H et al. (2022) Nat Plants 8:999 — Plant PBS optimisation
7Nelson JW et al. (2022) Nat Chem Biol 18:1172 — tevopreQ1
8Zong Y et al. (2022) Nat Biotechnol 40:1394 — ePPE
9Xu R et al. (2023) Nat Plants 9:1820 — PE4/PE5 MLH1dn in plants
10Jin S et al. (2023) Nat Protoc 18:831 — Plant PE protocol
11SantaLucia J (1998) PNAS 95:1460 — NN thermodynamics
12Anzalone AV et al. (2022) Nat Biotechnol 40:731 — twinPE
Step-by-Step Guide

Complete User Guide

Follow these steps from start to finish to design your first plant prime editing experiment.

Step 1
Open Module 1 — Allelic Variant Finder
Click Launch Tool or Module 1 in the navigation. You will land directly on the Allelic Variant Finder.
1aSelect your input mode: CDS Comparison (paste wild-type and reference CDS) or Direct Edit Entry (specify edit manually).
1bPaste your sequences in FASTA or plain ATGC format. The NW aligner detects all SNPs, insertions, and deletions automatically.
1cReview the variant table. Each row shows: genomic position, reference base, alternate base, codon context, amino acid change, and impact classification (Conservative / Non-conservative).
1dTick the checkbox(es) next to the edit(s) you want to install via prime editing. Multiple edits can be selected for a single pegRNA.
1eFetch the full genomic sequence (exons + introns) from 8 integrated databases: NCBI (gene ID / accession), TAIR (Arabidopsis AT loci), Ensembl Plants (grasses), RAPdb (rice RAP loci), RGAP/MSU (rice LOC loci), Sol Genomics (tomato Solyc IDs), Gramene (wheat/barley), or Phytozome (JGI) — or paste the sequence manually. Required for PAM site scanning in Module 2.
1fClick Continue to Module 2. All variant data and the genomic sequence are automatically passed to the pegRNA Designer.
Alt 1
✏️ Direct Design Mode — Module 2 (Skip Module 1)
Already know the exact position and bases of your edit in the genomic sequence? Use Direct Design mode in Module 2 to skip the CDS comparison in Module 1 and specify your edit manually — paste the genomic sequence, enter position and base change, and run pegRNA design directly.
B1 Open Module 2 from the navigation bar. In the left sidebar you will see two mode buttons at the top: 📥 From Module 1 and ✏️ Direct Design. Click ✏️ Direct Design.
B2 Paste your full genomic sequence (exons + introns, plain ATGC) into the Genomic Sequence field. This is the same sequence you would fetch from a database in Module 1. The length counter updates live.
B3 In the Edit Entry panel that appears, define each edit you want to install:
  • Position: 1-based position of the edit within your genomic sequence
  • Ref base: the original base at that position (A / T / G / C)
  • Alt base: the new base to install (A / T / G / C) or del for deletion
A context preview appears below each row showing ±10 nt around the edit so you can verify the position is correct.
B4 Multi-edit support: click + Add another edit to add more edits. All edits ≤25 nt apart are encoded in a single RT template — no extra pegRNA needed. A span indicator warns if edits are too far apart (>34 nt: separate pegRNAs needed for PE2/PE3 systems; twinPE/PPE/ePPE3 are exempt as two nicks bracket the edits).
B5 Select your PE system and PAM from the cards/pills in Step 1, then click Design pegRNA Candidates. The tool scans both strands for PAM sites, scores spacers, and generates PBS/RT/nick candidates — exactly the same as when data comes from Module 1.
B6 Complete Steps 2–7 in Module 2 as normal (select spacer, PBS, RT template, optionally nick sgRNA and second pegRNA), then click Proceed to Module 3. All data is passed to the Cloning module automatically.
Step 2
Design Your pegRNA — Module 2
Module 2 automatically scans the genomic sequence for PAM sites and generates ranked pegRNA components.
2aSelect your PE system from the card row: PE2, PE2max, PE3, PE3b, PE4/PE5, ePPE, PPE/ePPE3, or twinPE. The tool adjusts all scoring rules accordingly.
2bChoose your PAM: NGG (SpCas9, default), NG, NGA, NNGRRT (SaCas9), NRN / NYN (SpRY near-PAMless). The IUPAC-aware scanner covers both strands.
2cReview the spacer table. Spacers are ranked by nick-to-edit distance (primary), structural ΔG (secondary), and GC% (tertiary). The distance column shows near/far distances for multi-edit designs. Select the best spacer.
2dUse the PBS ΔG Heatmap to select PBS length. Cells are colour-coded by worst ΔG including PBS↔RT (the #1 failure mode). ★ marks lengths in the candidate table. Click a cell to jump to that length below.
2eReview the RT template candidates. Each shows length, GC%, edit positions, and structural risk. For twinPE and PPE, repeat for the second pegRNA (Step 7 in Module 2).
2fFor PE3/PE3b/PE4/PE5: select a nick sgRNA from the automatically generated candidates. Optimal nick distance: 40–90 nt. PE3b candidates have PAM disrupted by your edit.
2gReview the Assembly diagram. The full annotated pegRNA sequence and ΔG secondary structure analysis are shown. The linker is auto-selected by ΔG minimisation.
2hClick Proceed to Module 3. All pegRNA components, selected variants, and PE system are passed to the Cloning module.
Step 3
Select Vector & Cloning Strategy — Module 3
Module 3 recommends vectors for your PE system and species, then generates all cloning primers. You can also use Direct Assembly mode to enter pegRNA sequences manually without running Modules 1 or 2.
3aReview the vector recommendation grid. Vectors are ranked by compatibility with your PE system and plant type. Cassette badges (✓ Nick / ⚡ Dual / Single) show built-in support. Click a vector card to select it.
3bCheck the RE site conflict scan. If BsaI, BsmBI, BbsI or Esp3I sites are detected inside your pegRNA insert, the tool flags them and suggests alternative strategies.
3cChoose a cloning strategy (5 main options): BsaI Golden Gate (default), BsmBI swap, Esp3I, One-Step PCR + Gibson (fastest), or gBlock + Gibson. Each generates a dedicated primer set. The strategy panel also offers Gibson Assembly, In-Fusion HD, and Full-cassette RE as additional options.
3dReview the primer cards. Each primer (P1–P12 for PPE/twinPE) shows sequence, Tm, GC%, synthesis method, and QC badges. P1:P3 heterodimer risk and P3 scaffold fold risk are reported.
3eCheck the PCR cycling conditions panel. Step 1 and Step 2 annealing temperatures are computed from actual primer Tms using NEB Q5 Hot-Start parameters.
3fExport your order: click Export IDT CSV for bulk upload to IDT, Export Twist for gBlock fragments, or Export Protocol for a complete formatted text protocol for your lab notebook.
Alt 2
✏️ Direct Assembly Mode — Skip Modules 1 & 2
Already have your pegRNA sequences from a previous design, a published study, or an external tool? Use Direct Assembly mode in Module 3 to go straight to vector selection and primer design — no genomic sequence or CDS comparison needed.
A1 Open Module 3 directly from the navigation bar (or click the workflow card on the home page). At the top of Step 1 you will see two mode buttons: 📥 From Module 2 and ✏️ Direct Assembly. Click ✏️ Direct Assembly.
A2 Select your PE system from the 10-card grid that appears: PE2, PE2max, PE3, PE3b, PE4, PE5, ePPE, PPE, ePPE3, or twinPE. The field layout below automatically adjusts based on your choice — different fields appear for single-pegRNA systems vs. paired systems vs. nick-requiring systems.
A3 Enter your sequences in the fields that appear. Required fields depend on PE system:
  • All systems: Spacer (20 nt, 5′→3′) · RT Template · PBS
  • PE2max / ePPE / PPE / ePPE3: Linker + tevopreQ1 is auto-appended — no entry needed
  • PE3 / PE4: Nick sgRNA Spacer (non-edited strand)  ·  PE3b / PE5: Nick sgRNA Spacer (edited strand — PAM disrupted by edit)
  • PPE / ePPE3 / twinPE: pegRNA-2 fields — Spacer-2, RT Template-2, PBS-2
Each field shows a live length counter and turns green ✓ when the sequence is valid or red ✗ when out of range.
A4 Watch the Full pegRNA Preview build in real time as you type. It shows the colour-coded full sequence (Spacer · Scaffold · RT · PBS · Linker+tevo if applicable) with component lengths. This lets you verify the assembly before proceeding.
A5 When all required fields are valid, the ✅ Confirm Sequences & Continue → button appears. Click it. The tool builds a complete data object from your sequences and loads it — the sidebar updates to show ✏️ Direct Assembly Data with your full annotated pegRNA sequence.
A6 Select your plant type (Dicot / Monocot), target organism, and cloning priority in the panel below. The vector grid updates automatically to show compatible vectors ranked for your PE system and plant species. Click a vector card to select it.
A7 Click Confirm Vector & Continue →. From this point the workflow is identical to the standard route — Step 2 (Cloning Strategy & RE site scan), Step 3 (pegRNA Assembly editor + primer design P1–P12), and Step 4 (complete lab protocol with PCR conditions, Golden Gate / Gibson protocol, transformation and colony screening steps).
A8 To start a new Direct Assembly entry, click ↺ Clear Fields at the bottom of the Direct Assembly panel to reset all inputs and PE system selection without leaving Module 3. To return to Module 2 data, click the 📥 From Module 2 toggle at the top.
Tips
Troubleshooting & Best Practices
💡No spacers found? Switch to NG or SpRY (NRN/NYN) PAM for more permissive site coverage, or extend your genomic sequence window.
💡RT template empty? Increase RT max length in the sidebar parameters (try 40 nt). Check that all edits are within ~34 nt of each other.
💡PBS heatmap all red? Try a different spacer at a different nick position — the PBS/RT structural risk depends entirely on the sequence downstream of the nick.
💡RE site conflict? Switch to gBlock + Gibson (Method F) or One-Step PCR + Gibson — neither requires restriction sites inside the insert.
💡Low plant efficiency? Upgrade from PE2 to ePPE (same cloning, 5.8× improvement) or PPE (dual cassette, highest reported efficiency in plants, Lin 2021).
💡Already have pegRNA sequences? Use Direct Assembly mode in Module 3 — click the ✏️ Direct Assembly toggle on Step 1, select your PE system, enter your spacer/RT/PBS sequences, and proceed directly to vector selection and primer design without running Modules 1 or 2.
💡Want to start over? Use the ⟳ Reset Session button in the top navigation bar to clear all three modules. Or use module-level resets: ↺ Clear Sequences (M1), ↺ Re-design (M2), or ↺ Start New Design (M3) for targeted resets that preserve other data.
💡twinPE or PPE giving wrong RT balance warning? The balance check is disabled for PPE — RT lengths are determined by complementarity, not by a balance criterion.
💡P1:P3 heterodimer warning? Select a different spacer (changes P1 annealing sequence) or a shorter RT template (changes P3 sequence).
Research Team

Meet the Team

Plant Prime Editor v1.0 is developed as part of bioinformatics research in plant genomics and precision genome editing.

Voodikala S Akhil
Voodikala S Akhil
⚙ Lead Developer
Ph.D. Scholar
Division of Nematology
ICAR–Indian Agricultural Research Institute
New Delhi — 110 012
ICAR-IARI
Dr. Tushar Kanti Dutta
Dr. Tushar Kanti Dutta
★ Supervisor
Senior Scientist
Division of Nematology
ICAR–Indian Agricultural Research Institute
New Delhi — 110 012
ICAR-IARI
Chanumolu Hari Gopala Krishna
Chanumolu Hari Gopala Krishna
🔬 Technical
Ph.D. Scholar
Division of Plant Physiology
ICAR–Indian Agricultural Research Institute
New Delhi — 110 012
ICAR-IARI
Contact & Support

Get in Touch

Have questions or want to collaborate? We would love to hear from you.

💬
General Support

For general questions about Plant Prime Editor v1.0 — module usage, pegRNA design, primer interpretation, or any technical issue — please contact our support team.

✉ akhilprime756@gmail.com ✉ nemaiari@gmail.com
🤝
Research Collaborations

Interested in collaborating on plant prime editing research, suggesting new features, or integrating Plant Prime Editor v1.0 into your pipeline? We welcome research partnerships.

✉ akhilprime756@gmail.com ✉ nemaiari@gmail.com
How to Cite

Cite this Tool

If you use Plant Prime Editor v1.0 in your research, please cite it using the reference below.

Voodikala S Akhil, Tushar K Dutta, & Chanumolu, H. G. K. (2026). Plant Prime Editor v1.0. Retrieved March 24, 2026, from pegRNA Design Platform website: https://akprimeedit.com